ID: 1009283322_1009283332

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1009283322 1009283332
Species Human (GRCh38) Human (GRCh38)
Location 6:61779244-61779266 6:61779293-61779315
Sequence CCACTTCCTAACATCTGAAGTCC GGGCCATAAAAAATAACCCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 21, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!