ID: 1009366372_1009366391

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1009366372 1009366391
Species Human (GRCh38) Human (GRCh38)
Location 6:62860837-62860859 6:62860886-62860908
Sequence CCCCTGCCAAATGGATCTTAAGA CTTACTCCTCATATGGTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 179} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!