ID: 1009366438_1009366451

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1009366438 1009366451
Species Human (GRCh38) Human (GRCh38)
Location 6:62861055-62861077 6:62861094-62861116
Sequence CCCATATGGCGGGGGGTGTCCAC ATTGTAAGAGCCGGGGGTAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!