ID: 1009381122_1009381128

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1009381122 1009381128
Species Human (GRCh38) Human (GRCh38)
Location 6:63031415-63031437 6:63031456-63031478
Sequence CCATGAAAATACCTAAATGTCCC CAGTAGTCTTAGTTGTGGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 185} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!