ID: 1009396994_1009396999

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1009396994 1009396999
Species Human (GRCh38) Human (GRCh38)
Location 6:63211584-63211606 6:63211620-63211642
Sequence CCAGGAGACTGGCGCACCTTCCC ACCTGCGTGATGCACTACACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 176} {0: 2, 1: 2, 2: 1, 3: 2, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!