ID: 1009404890_1009404902

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1009404890 1009404902
Species Human (GRCh38) Human (GRCh38)
Location 6:63300118-63300140 6:63300157-63300179
Sequence CCAAGCCCACTATGGCCCTGCCC GCCTGCTGGCCATGCTGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 367} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!