ID: 1009425273_1009425281

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1009425273 1009425281
Species Human (GRCh38) Human (GRCh38)
Location 6:63506935-63506957 6:63506962-63506984
Sequence CCCTGCAATCCCAGGGAAGCAGG AGGGAGTAGAAGAATGAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 97, 4: 998}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!