ID: 1009449968_1009449978

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1009449968 1009449978
Species Human (GRCh38) Human (GRCh38)
Location 6:63789392-63789414 6:63789436-63789458
Sequence CCAGCCCCAGAAACAGAGCACCA ATGAGGGTTCTGGTCAACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 817} {0: 1, 1: 0, 2: 2, 3: 4, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!