ID: 1009502526_1009502531

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1009502526 1009502531
Species Human (GRCh38) Human (GRCh38)
Location 6:64433250-64433272 6:64433270-64433292
Sequence CCATATTTCAACAATAACAAAAT AATAAAAGAGGGTAAAACTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 191, 4: 1799} {0: 1, 1: 0, 2: 1, 3: 38, 4: 465}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!