ID: 1009504773_1009504775

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1009504773 1009504775
Species Human (GRCh38) Human (GRCh38)
Location 6:64463105-64463127 6:64463121-64463143
Sequence CCCGGCTATTTATTTTTTGGATT TTGGATTTTTTTACTAGAGATGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 153, 3: 2669, 4: 5839} {0: 1, 1: 28, 2: 2637, 3: 3484, 4: 32528}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!