ID: 1009504773_1009504779

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1009504773 1009504779
Species Human (GRCh38) Human (GRCh38)
Location 6:64463105-64463127 6:64463146-64463168
Sequence CCCGGCTATTTATTTTTTGGATT TTTCACCGTGTTAGCCAGGATGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 153, 3: 2669, 4: 5839} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!