|
Left Crispr |
Right Crispr |
| Crispr ID |
1009520952 |
1009520961 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:64681614-64681636
|
6:64681645-64681667
|
| Sequence |
CCGGGCGCGGTGGCTCAGGCCTG |
ACATTTTGGGAGGCTGAGGCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 491, 1: 34132, 2: 89308, 3: 152461, 4: 169741} |
{0: 362, 1: 9066, 2: 85589, 3: 211909, 4: 333105} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|