ID: 1009520974_1009520979

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1009520974 1009520979
Species Human (GRCh38) Human (GRCh38)
Location 6:64681754-64681776 6:64681782-64681804
Sequence CCGGCTCAGTCAGACTAGGGTCC CCTTTTAAGCTGTTTGTGGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 6, 3: 28, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!