ID: 1009540791_1009540794

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1009540791 1009540794
Species Human (GRCh38) Human (GRCh38)
Location 6:64955660-64955682 6:64955680-64955702
Sequence CCATGGGTTTTGCTTAGGCATTC TTCTTGGGTAATAACTACGATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 8, 3: 19, 4: 153} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!