ID: 1009548255_1009548258

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1009548255 1009548258
Species Human (GRCh38) Human (GRCh38)
Location 6:65050215-65050237 6:65050250-65050272
Sequence CCTATATGCTTGCTGCCAAAATA TAGCACTTACAACGAACTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 180} {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!