ID: 1009548977_1009548980

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1009548977 1009548980
Species Human (GRCh38) Human (GRCh38)
Location 6:65061763-65061785 6:65061797-65061819
Sequence CCATCTGGGCTAAATCACACTGT CCTCATAGGAACCATCATGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!