ID: 1009602618_1009602627

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1009602618 1009602627
Species Human (GRCh38) Human (GRCh38)
Location 6:65821837-65821859 6:65821854-65821876
Sequence CCAGAGGCTGAGAAGCGTAGTGG TAGTGGGAGTGGGGGGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 52, 2: 562, 3: 1194, 4: 1672} {0: 1, 1: 1, 2: 6, 3: 81, 4: 750}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!