ID: 1009635769_1009635775

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1009635769 1009635775
Species Human (GRCh38) Human (GRCh38)
Location 6:66262617-66262639 6:66262640-66262662
Sequence CCCCCATGTAGAGCTTTTATGCC ATAGTTGGTCCAACATTCTGTGG
Strand - +
Off-target summary No data {0: 22, 1: 42, 2: 41, 3: 37, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!