ID: 1009727707_1009727712

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1009727707 1009727712
Species Human (GRCh38) Human (GRCh38)
Location 6:67556953-67556975 6:67556988-67557010
Sequence CCAACTTGCTTCCATTCTCCCAG ACACCAATCAAATGTAGATTTGG
Strand - +
Off-target summary {0: 1, 1: 107, 2: 3192, 3: 4348, 4: 2961} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!