ID: 1009764935_1009764938

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1009764935 1009764938
Species Human (GRCh38) Human (GRCh38)
Location 6:68060149-68060171 6:68060166-68060188
Sequence CCCTCAACAAGGAGCAGCTGGAG CTGGAGACAAACTTGGAGCGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 303} {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!