ID: 1009806493_1009806495

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1009806493 1009806495
Species Human (GRCh38) Human (GRCh38)
Location 6:68606928-68606950 6:68606962-68606984
Sequence CCATCTTCTGCAGATAACTACTC GACAGCTCCCGGCCTGTTACTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 173, 3: 206, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!