ID: 1009811534_1009811539

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1009811534 1009811539
Species Human (GRCh38) Human (GRCh38)
Location 6:68673839-68673861 6:68673858-68673880
Sequence CCTGGGACAAATCTTTGTCCTTC CTTCAAATGCAGAGGGAATAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 19, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!