ID: 1009847497_1009847506

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1009847497 1009847506
Species Human (GRCh38) Human (GRCh38)
Location 6:69151802-69151824 6:69151841-69151863
Sequence CCAAATCTCATCTTTAATTTTAG GTGCCATGGGAGGGACCCAGTGG
Strand - +
Off-target summary No data {0: 11, 1: 360, 2: 1109, 3: 2975, 4: 5067}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!