ID: 1009869599_1009869601

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1009869599 1009869601
Species Human (GRCh38) Human (GRCh38)
Location 6:69436989-69437011 6:69437025-69437047
Sequence CCTTGATTTGAATGTTACCTTAG TGTTTTGTTGTTGTTTTCACTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 13, 3: 204, 4: 2004}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!