ID: 1009910121_1009910123

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1009910121 1009910123
Species Human (GRCh38) Human (GRCh38)
Location 6:69915786-69915808 6:69915802-69915824
Sequence CCAATGTATTACTTTTCATTAGG CATTAGGAAAATAAATACAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 46, 4: 541}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!