ID: 1009910714_1009910718

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1009910714 1009910718
Species Human (GRCh38) Human (GRCh38)
Location 6:69923667-69923689 6:69923707-69923729
Sequence CCAACATATTTGTAGGACTCCAG ACAGGGCTGTGTGAAAACTCCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 17, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!