|
Left Crispr |
Right Crispr |
| Crispr ID |
1009929480 |
1009929483 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:70160130-70160152
|
6:70160169-70160191
|
| Sequence |
CCTGAGACTGGGTAATTTATAAA |
GACCCACAGCTCCACGTGGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6401, 1: 13084, 2: 14111, 3: 11019, 4: 7181} |
{0: 1, 1: 28, 2: 795, 3: 4974, 4: 8072} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|