ID: 1009952498_1009952506

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1009952498 1009952506
Species Human (GRCh38) Human (GRCh38)
Location 6:70413478-70413500 6:70413529-70413551
Sequence CCCTCGGGACTGGGGCGACTGCG GCCGAGCCGCGGTGACGAACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 44} {0: 1, 1: 0, 2: 0, 3: 1, 4: 22}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!