|
Left Crispr |
Right Crispr |
| Crispr ID |
1009953095 |
1009953099 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:70419131-70419153
|
6:70419159-70419181
|
| Sequence |
CCTGTTTTGGCCAGGCATGGTGG |
GCCTGTAATCCCAGCACTTTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 28, 2: 174, 3: 703, 4: 2141} |
{0: 215700, 1: 270647, 2: 186590, 3: 142154, 4: 223611} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|