|
Left Crispr |
Right Crispr |
Crispr ID |
1009953095 |
1009953106 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
6:70419131-70419153
|
6:70419184-70419206
|
Sequence |
CCTGTTTTGGCCAGGCATGGTGG |
GCCGAGGCAGGCAGATCACGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 6, 1: 28, 2: 174, 3: 703, 4: 2141} |
{0: 2343, 1: 13681, 2: 40660, 3: 57268, 4: 59491} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|