ID: 1009958452_1009958453

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1009958452 1009958453
Species Human (GRCh38) Human (GRCh38)
Location 6:70486941-70486963 6:70486955-70486977
Sequence CCTAGTTTTCTGCACTGCAGAAA CTGCAGAAATAGAGAAGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 316} {0: 1, 1: 0, 2: 1, 3: 70, 4: 634}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!