|
Left Crispr |
Right Crispr |
| Crispr ID |
1009988163 |
1009988168 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:70806498-70806520
|
6:70806523-70806545
|
| Sequence |
CCGTGGGCTGCACCCACTATCCA |
CAGTCCCAGTGAGATGAACCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 15, 1: 547, 2: 822, 3: 683, 4: 488} |
{0: 320, 1: 800, 2: 1270, 3: 925, 4: 1105} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|