ID: 1010003259_1010003267

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1010003259 1010003267
Species Human (GRCh38) Human (GRCh38)
Location 6:70969344-70969366 6:70969389-70969411
Sequence CCAGGTCAGATGCCCCTCTGAAA CAGAGGAGGCAGAGTCTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 91} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!