ID: 1010022068_1010022071

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1010022068 1010022071
Species Human (GRCh38) Human (GRCh38)
Location 6:71171890-71171912 6:71171911-71171933
Sequence CCTTGGGTTTATTTGCTTTCTGT GTTTTTCTAGGTTTTTGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 62, 4: 605} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!