ID: 1010049421_1010049426

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1010049421 1010049426
Species Human (GRCh38) Human (GRCh38)
Location 6:71485242-71485264 6:71485269-71485291
Sequence CCTTTAAAGGCTATATTCCCAAA GTTACATTCTGAGATGCTAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 63, 3: 322, 4: 1020}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!