ID: 1010083093_1010083113

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1010083093 1010083113
Species Human (GRCh38) Human (GRCh38)
Location 6:71886696-71886718 6:71886735-71886757
Sequence CCCTCGCCTCTCCCGCCGCGCCT GCCGGCCGAGGCTGGGCTGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 41, 4: 767} {0: 1, 1: 0, 2: 4, 3: 49, 4: 431}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!