ID: 1010152269_1010152272

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1010152269 1010152272
Species Human (GRCh38) Human (GRCh38)
Location 6:72747155-72747177 6:72747196-72747218
Sequence CCACAAACCTCAGGGGTTATGGC TTAATTTTAAATTATATCACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 11, 3: 88, 4: 757}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!