ID: 1010162855_1010162862

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1010162855 1010162862
Species Human (GRCh38) Human (GRCh38)
Location 6:72878523-72878545 6:72878575-72878597
Sequence CCATGACAGGGAATCAATTACTC GGAATATAGAGACCAAAATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 108} {0: 1, 1: 0, 2: 1, 3: 47, 4: 332}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!