ID: 1010258068_1010258076

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1010258068 1010258076
Species Human (GRCh38) Human (GRCh38)
Location 6:73783108-73783130 6:73783151-73783173
Sequence CCCTGGCAGTGCTGCTAACTGAA TCCCAGGAGTCACAGGGAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 48, 4: 412}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!