ID: 1010262299_1010262303

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1010262299 1010262303
Species Human (GRCh38) Human (GRCh38)
Location 6:73830907-73830929 6:73830923-73830945
Sequence CCCTATTCTCTCTCTCTCTCTCA TCTCTCAGACCTAAGATCAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!