ID: 1010275255_1010275257

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1010275255 1010275257
Species Human (GRCh38) Human (GRCh38)
Location 6:73961675-73961697 6:73961715-73961737
Sequence CCTCTTACTTAAGGACTAGTTAT ATGTACGGAATGAATTGTATAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 8, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!