ID: 1010305105_1010305110

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1010305105 1010305110
Species Human (GRCh38) Human (GRCh38)
Location 6:74310589-74310611 6:74310638-74310660
Sequence CCGTACAATTTGTGCAGTTAATG ATACATCCTCCTCAGCTGACAGG
Strand - +
Off-target summary No data {0: 119, 1: 124, 2: 73, 3: 35, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!