ID: 1010389888_1010389896

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1010389888 1010389896
Species Human (GRCh38) Human (GRCh38)
Location 6:75324795-75324817 6:75324846-75324868
Sequence CCAACTGATCTTCAACAAGGCGA CCTGTTCAACAGACGGTGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 103, 3: 1315, 4: 4646}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!