ID: 1010415127_1010415129

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1010415127 1010415129
Species Human (GRCh38) Human (GRCh38)
Location 6:75602832-75602854 6:75602856-75602878
Sequence CCTTTGAGAGTGCGCGCTGAAGT TTTGACATTTAAAAAATTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37} {0: 1, 1: 0, 2: 13, 3: 186, 4: 1485}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!