ID: 1010415127_1010415132

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1010415127 1010415132
Species Human (GRCh38) Human (GRCh38)
Location 6:75602832-75602854 6:75602863-75602885
Sequence CCTTTGAGAGTGCGCGCTGAAGT TTTAAAAAATTTTGGGGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37} {0: 1, 1: 2, 2: 6, 3: 82, 4: 804}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!