ID: 1010415592_1010415598

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1010415592 1010415598
Species Human (GRCh38) Human (GRCh38)
Location 6:75607885-75607907 6:75607933-75607955
Sequence CCTAACACTGTCTGTTGAACTAG CATTCCATGGAATATGAACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 104} {0: 1, 1: 0, 2: 0, 3: 23, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!