ID: 1010505068_1010505071

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1010505068 1010505071
Species Human (GRCh38) Human (GRCh38)
Location 6:76646998-76647020 6:76647019-76647041
Sequence CCTCCCTCAGGCTGCTTCTGGTA TAAAAATTACTTTATTGATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 217} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!