ID: 1010510586_1010510591

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1010510586 1010510591
Species Human (GRCh38) Human (GRCh38)
Location 6:76713732-76713754 6:76713768-76713790
Sequence CCTGGATAATTTTTTATTTTTAA TCACCATGTTGGCCATGAATAGG
Strand - +
Off-target summary {0: 3, 1: 90, 2: 2310, 3: 23272, 4: 53735} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!