ID: 1010569968_1010569982

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1010569968 1010569982
Species Human (GRCh38) Human (GRCh38)
Location 6:77464134-77464156 6:77464170-77464192
Sequence CCGCCACCGCCACCCTGGTCCCA GAGCCATGCCACTGGGTGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 20, 3: 101, 4: 829} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!