ID: 1010603152_1010603154

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1010603152 1010603154
Species Human (GRCh38) Human (GRCh38)
Location 6:77855494-77855516 6:77855541-77855563
Sequence CCTTAATGAGTATGCTTGGAAGA GATTTCCATGCTTTGCTAATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 12, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!